Flu Singapura sudah masuk ke Indonesia sejak ditemukan 8 kasus di Jakarta tahun 2009. Banyak yang khawatir flu Singapura ini seperti flu burung atau flu babi yang mematikan. Meski penularannya mudah,flu Singapura tidaklah seganas flu burung ataupun flu babi. Seperti halnya pada Bahaya Daging Babi Sadari Dan Cegah perlu adanya pencegahan yang sedini mungkin berkaitan dengan hal tersebut.

Flu Singapura dalam ilmu kedokteran dikenal dengan Hand Foot and Mouth Disease (HFMD). Penyakit ini menyerupai flu yang disertai dengan terbentuknya lesi vesikular (bintil berisi cairan) di sekitar tangan, kaki, dan mulut.

Gejala awal dari flu Singapura sama seperti flu pada umumnya seperti demam, sakit tenggorokan, pilek, sakit sepala, nyeri sendi, hilang nafsu makan, peradangan pada saluran nafas atas.

Yang paling khas dari flu Singapura ini adalah timbulnya lesi vesikular atau bintil cairan di tangan, kaki, mulut dan bahkan bokong. Namun sebagian tidak menunjukkan gejala apa-apa (asymptom).

"Flu Singapura ini tidaklah berbahaya dan ganas, bahkan penyakit ini bisa sembuh dengan sendirinya bila daya tahan tubuh pasein baik," kata dr R. Fera Ibrahim M.Sc.,Ph.D.,SpMK, peneliti dan dosen di Departemen Mikrobiologi Klinik FKU.

Flu Singapura atau HFMD disebabkan oleh virus golongan Picornaviridae, yang paling banyak adalah Enterovirus secara umum, termasuk Coxsackievirus A16, EV 71 dan Echovirus.

Flu Singapura paling banyak menyerang bayi dan anak-anak, dan sangat jarang menyerang orang dewasa, namun masih ada kemungkinan. Kebanyakan orang dewasa memiliki sistem kekebalan tubuh cukup kuat untuk mengalahkan virus ini.

Menurut dr Fera, masa inkubasi penyakit ini sekitar 1 hingga 3 hari. Virus akan menginfeksi orang dengan sistem kekebalan lemah, yang rentan pada bayi dan anak-anak. Penyakit ini bisa sembuh dengan sendirinya bila daya tahan tubuh pasien membaik.

dr Fera juga menuturkan, tak ada obat yang spesifik untuk anti virus flu Singapura ini. Gejala-gejala yang ditimbulkan dapat segera hilang dengan menggunakan obat-obatan atau multivitamin yang biasa digunakan untuk influenza. Biasanya dokter akan memberikan interferon untuk menaikkan sistem kekebalan tubuh pasien.

Flu Singapura sangat mudah menular. Penularannya sama seperti penularan flu pada umumnya, yaitu melalui kontak langsung saat bicara, batuk, bersin, yang dapat mengeluarkan cairan saluran nafas. Bisa juga melalui cairan lesi vasekular yang mengenai kulit. Yang paling rentan pada anak-anak adalah melalui mainan yang digigit.

Untuk pencegahan, hindarilah kontak langsung dengan penderitanya. Terutama bagi anak-anak yang rentan terhadap berbagai macam penyakit.


dan ini adalah penjelasan lebih lanjut mengenai flu singapura tersebut.

penjelasan lebih lanjut mengenai flu singapura[silahkan click show sobat] :

"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:

Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ).
Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :

Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10

LABORATORIUM :

Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.

Diagnosa Laboratorium adalah sebagai berikut :

1. Deteksi Virus :

o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.

2. Deteksi RNA :

RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)

3. Serodiagnosis :

Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :

o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :

Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut
Analgesik misal parasetamol
Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam
Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:
Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Hand-Foot-Mouth Disease (HFMD)

Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

Diagnosis :
Manifestasi klinis dan isolasi virus dengan preparat Tzank.

Diagnosis Banding : Varisela, herpes

Terapi : Simptomatis

"Flu Singapura" sebenarnya adalah penyakit yang didunia kedokteran dikenal sebagai Hand, Foot, and Mouth Disease (HFMD) atau penyakit Kaki, Tangan dan Mulut ( KTM )
Penyakit KTM ini adalah penyakit infeksi yang disebabkan oleh virus RNA yang masuk dalam famili Picornaviridae (Pico, Spanyol = kecil ), Genus Enterovirus ( non Polio ). Genus yang lain adalah Rhinovirus, Cardiovirus, Apthovirus. Didalam Genus enterovirus terdiri dari Coxsackie A virus, Coxsackie B virus, Echovirus dan Enterovirus.
Penyebab KTM yang paling sering pada pasien rawat jalan adalah Coxsackie A16, sedangkan yang sering memerlukan perawatan karena keadaannya lebih berat atau ada komplikasi sampai meninggal adalah Enterovirus 71. Berbagai enterovirus dapat menyebabkan berbagai penyakit.

EPIDEMIOLOGI:
Penyakit ini sangat menular dan sering terjadi dalam musim panas. KTM adalah penyakit umum/?biasa? pada kelompok masyarakat yang ?crowded? dan menyerang anak-anak usia 2 minggu sampai 5 tahun ( kadang sampai 10 tahun ). Orang dewasa umumnya kebal terhadap enterovirus. Penularannya melalui kontak langsung dari orang ke orang yaitu melalui droplet, pilek, air liur (oro-oro), tinja, cairan dari vesikel atau ekskreta. Penularan kontak tidak langsung melalui barang, handuk, baju, peralatan makanan, dan mainan yang terkontaminasi oleh sekresi itu. Tidak ada vektor tetapi ada pembawa (?carrier?) seperti lalat dan kecoa. Penyakit KTM ini mempunyai imunitas spesifik, namun anak dapat terkena KTM lagi oleh virus strain Enterovirus lainnya. Masa Inkubasi 2 ? 5 hari.

GAMBARAN KLINIK :
Mula-mula demam tidak tinggi 2-3 hari, diikuti sakit leher (pharingitis), tidak ada nafsu makan, pilek, gejala seperti ?flu? pada umumnya yang tak mematikan. Timbul vesikel yang kemudian pecah, ada 3-10 ulcus dumulut seperti sariawan ( lidah, gusi, pipi sebelah dalam ) terasa nyeri sehingga sukar untuk menelan.
Bersamaan dengan itu timbul rash/ruam atau vesikel (lepuh kemerahan/blister yang kecil dan rata), papulovesikel yang tidak gatal ditelapak tangan dan kaki.
Kadang-kadang rash/ruam (makulopapel) ada dibokong. Penyakit ini membaik sendiri dalam 7-10 hari.
Bila ada muntah, diare atau dehidrasi dan lemah atau komplikasi lain maka penderita tersebut harus dirawat. Pada bayi/anak-anak muda yang timbul gejala berat , harus dirujuk kerumah sakit sebagai berikut :

o Hiperpireksia ( suhu lebih dari 39 der. C).
o Demam tidak turun-turun (?Prolonged Fever?)
o Tachicardia.
o Tachypneu
o Malas makan, muntah atau diare dengan dehidrasi.
o Lethargi
o Nyeri pada leher,lengan dan kaki.
o Serta kejang-kejang.

Komplikasi penyakit ini adalah :

o Meningitis (aseptic meningitis, meningitis serosa/non bakterial)
o Encephalitis ( bulbar )
o Myocarditis (Coxsackie Virus Carditis) atau pericarditis
o Paralisis akut flaksid (?Polio-like illness? )

Satu kelompok dengan penyakit ini adalah :

1. Vesicular stomatitis dengan exanthem (KTM) - Cox A 16, EV 71 (Penyakit ini)
2. Vesicular Pharyngitis (Herpangina) - EV 70
3. Acute Lymphonodular Pharyngitis - Cox A 10

LABORATORIUM :
Sampel ( Spesimen ) dapat diambil dari tinja, usap rektal, cairan serebrospinal dan usap/swab ulcus di mulut/tenggorokan, vesikel di kulit spesimen atau biopsi otak.
Spesimen dibawa dengan ?Hank?s Virus Transport?. Isolasi virus dencara biakan sel dengan suckling mouse inoculation.
Setelah dilakukan ?Tissue Culture?, kemudian dapat diidentifikasi strainnya dengan antisera tertentu / IPA, CT, PCR dll. Dapat dilakukan pemeriksaan antibodi untuk melihat peningkatan titer.
Diagnosa Laboratorium adalah sebagai berikut :
1. Deteksi Virus :
o Immuno histochemistry (in situ)
o Imunofluoresensi antibodi (indirek)
o Isolasi dan identifikasi virus.
Pada sel Vero ; RD ; L20B
Uji netralisasi terhadap intersekting pools
Antisera (SCHMIDT pools) atau EV-71 (Nagoya) antiserum.
2. Deteksi RNA :
RT-PCR
Primer : 5? CTACTTTGGGTGTCCGTGTT 3?
5? GGGAACTTCGATTACCATCC 3?
Partial DNA sekuensing (PCR Product)
3. Serodiagnosis :
Serokonversi paired sera dengan uji serum netralisasi terhadap virus EV-71 (BrCr, Nagoya) pada sel Vero.
Uji ELISA sedang dikembangkan.
Sebenarnya secara klinis sudah cukup untuk mendiagnosis KTM, hanya kita dapat mengatahui apakah penyebabnya Coxsackie A-16 atau Enterovirus 71.

TATALAKSANA :
o Istirahat yang cukup
o Pengobatan spesifik tidak ada.
o Dapat diberikan :
Immunoglobulin IV (IGIV), pada pasien imunokompromis atau neonatus

Extracorporeal membrane oxygenation.

o Pengobatan simptomatik :
Antiseptik didaerah mulut Analgesik misal parasetamol Cairan cukup untuk dehidrasi yang disebabkan sulit minum dan karena demam Pengobatan suportif lainnya ( gizi dll )
Penyakit ini adalah ?self limiting diseases? ( berobat jalan ) yang sembuh dalam 7-10 hari, pasien perlu istirahat karena daya tahan tubuh menurun. Pasien yang dirawat adalah yang dengan gejala berat dan komplikasi tersebut diatas.

PENCEGAHAN DAN PENGENDALIAN PENYAKIT:

Penyakit ini sering terjadi pada masyarakat dengan sanitasi yang kurang baik. Pencegahan penyakit adalah dengan menghilangkan ?Overcrowding?, kebersihan (Higiene dan Sanitasi). Lingkungan dan perorangan misal cuci tangan, desinfeksi peralatan makanan, mainan, handuk yang memungkinkan terkontaminasi.
Bila perlu anak tidak bersekolah selama satu minggu setelah timbul rash sampai panas hilang. Pasien sebenarnya tak perlu diasingkan karena ekskresi virus tetap berlangsung beberapa minggu setelah gejala hilang, yang penting menjaga kebersihan perorangan.
Di Rumah sakit ? Universal Precaution? harus dilaksanakan.
Penyakit ini belum dapat dicegah dengan vaksin (Imunisasi)

UPAYA PEMERINTAH DALAM HAL INI :
Meningkatkan survailans epidemiologi (perlu definisi klinik)
Memberikan penyuluhan tentang cara-cara penularan dan pencegahan KTM untuk memotong rantai penularan.
Memberikan penyuluhan tentang tamda-tanda dan gejala KTM
Menjaga kebersihan perorangan.
Bila anak tidak dirawat, harus istirahat di rumah karena :
o Daya tahan tubuh menurun.
o Tidak menularkan kebalita lainnya.
Menyiapkan sarana kesehatan tentang tatalaksana KTM termasuk pelaksanaan ?Universal Precaution?nya.

Hand-Foot-Mouth Disease (HFMD)
Etiologi : Coxsackievirus A 16
Cara Penularan : Droplets
Masa Inkubasi : 4 ? 6 Hari

Manifestasi Klinis :
Masa prodromal ditandai dengan panas subfebris, anoreksia, malaise dan nyeri tenggorokan yang timbul 1 ? 2 hari sebelum timbul enantem. Enantem adalah manifestasi yang paling sering pada HFMD. Lesi dimulai dengan vesikel yang cepat menjadi ulkus dengan dasar eritem, ukuran 4-8 mm yang kemudian menjadi krusta, terdapat pada mukosa bukal dan lidah serta dapat menyebar sampai palatum uvula dan pilar anterior tonsil. Eksantema tampak sebagai vesiko pustul berwarna putih keabu-abuan, berukuran 3-7 mm terdapat pada lengan dan kaki, pada permukaan dorsal atau lateral, pada anak sering juga terdapat di bokong. Lesi dapat berulang beberapa minggu setelah infeksi, jarang menjadibula dan biasanya asimptomatik, dapat terjadi rasa gatal atau nyeri pada lesi. Lesi menghilang tanpa bekas.

You can follow any responses to this entry through the RSS 2.0 feed. OR You might also like:

9 komentar

  1. Ardhiansyam Says:
  2. walau ga seganas flu burung, liat gambarnya ngeri juga sob :h:

     
  3. PeJhes Says:
  4. harus waspada nie..

     
  5. Osi Says:
  6. Betul2 penjelasan yang sangat lengkap...terima kasih info bermanfaatnya

     
  7. Zippy Says:
  8. Biarpun gak seganas flu burung, tapi tetep aja serem.
    Liat gambarnya aja ngeri, jangan sampai deh terserang penyakit gituan.

     
  9. Dunia Hape Says:
  10. wah..ngeri yah.
    Yang namanya flu, pasti cepet banget deh menyebar.
    Harus waspada.

     
  11. Bayu Lebond Says:
  12. koq kita suka import virus gitu tho bung...dari burung, babi sekarang malah singapura...

     
  13. rizkon a Says:
  14. @ Ardhiansyam: iya sobat dan harus tetap waspada
    @ PeJhes: ok sobat
    @ Osi: sama2 sobat
    @ Zippy: benar sobat,pencegahan solusi yang paling baik utuk saat ini
    @ Dunia Hape: waspadalah sobat
    @ Bayu Lebond: iya bung, memang demikian keadaan kita sekarang

     
  15. gak mutu Says:
  16. kalau dulu penyakit flu cuman pilek atau demam aja ...
    jaman sekarang malah lebih banyak jenisnya, sampe make nama-nama bintang dan negara segala ....

     
  17. rizkon a Says:
  18. @ gak mutu: memang berbagai macam varietas numplek di zaman sekarang ini.waspada sobat

     
:)) :)] ;)) ;;) :D ;) :p :(( :) :( :X =(( :-o :-/ :-* :| 8-} ~x( :-t b-( :-L x( =))

Post a Comment

terimakasih banyak atas partisipasinya sobat..

Tanggapan Anda akan selalu kami hargai. Saya akan mencoba untuk menjawab pertanyaan Anda sepengetahuan saya dan sesegera mungkin.
Catatan: Karena disini tempat saling berbagi tolong berikan komentar terbaik serta bijaksana sobat, komentar spam dan berbau sara akan dihapus segera setelah saya review.

٩(͡๏̯͡๏)۶ mohon maaf atas ketidaknyamanan ini, smg kita dapat mempererat lagi tali persaudaraan dengan saling berbagi, dan penghargaan terbesar dari saya sll untuk Anda.

Satu lagi sahabat, silahkan sematkan ID acount twitter Anda untuk berinteraksi dan mempererat tali silaturahim

Read in another language

Silahkan pilih bahasa :

Random Post | sehat-mu

SMS GRATIS SEPUASNYA! | sehat-mu